Biology Exams 4 U

Biology Exam Preparation Portal. Preparing with U 4 ur exams...

101 Biological Science Inventions and Discoveries

101 Biological Science Inventions and Discoveries

1.       Animal Cell- Theodore Schwann

2.       Plant Cell - Robert Hook

3.       Cell Theory - Schleiden, Schwann and Virchow

4.       Bacteria – Leeuwenhoek

5.       Gram Staining - Hans C Gram

6.       Virus- Dmitri Ivanovsky

7.       Prions- Stanley B. Prusiner (Prions-Infectious proteins)

8.       AIDS virus (HIV)  – Luc Montagnier

9.       Bacteriophages  discovered  by Frederick W. Twort in (1915) & term coined by Félix d’Hérelle  (1917)

10.   Binomial Nomenclature - Carl Linnaeus

11.   Five Kingdom Classification  - Robert H Whittaker

12.   Nucleus- Robert Brown

13.   Lysosome – Christian de Duve

14.   Golgi Complex – Camillo Golgi

15.   Mitochondria – Albert von Kolliker (The mitochondria is a double-membraned cell organelle, known as the powerhouse of the cell which is present in all eukaryotic cells.It was first discovered by Albert von Kolliker in the year 1857. It was named as bioblast by Richard Altman in the year 1886. The term mitochondria was coined by Carl Benda in the year 1898.)

16.   Gene on Chromosome- Walter S Sutton & Bovery. The term gene coined by Johannsen

17.   Chromosomes-  Hofmeister

18.   Cell Division (Mitosis) -Walther Flemming  & Edward Strasburger


19.   Meiosis - Oscar Hertwig (Meiosis was discovered and described for the first time in sea urchin eggs in 1876 by the German biologist Oscar Hertwig.)

20.   DNA Structure -Watson and Crick

21.   Artificial Gene- Har Gobind Khorana

22.   Process of Photosynthesis  - Jan Ingenhousz

23.   Clavin Cycle- Melvin Calvin

24.   Cell Respiration- Adolf Krebs

25.   Antigen, Blood Group – Land Steiner

26.   Autonomic Nervous System - James Langley

27.   Blood Circulation-  William Harvey

28.   Blood Transfusion-  James Blundell

29.   Pencillin – Alexander Fleming (1928)

30.   Insulin – Banting and Best

31.   Chloroform – Harrison and Simpson

32.   DDT – Paul Muller

33.   Stethoscope - Rene Laennec

34.   Heart Transplantation – Christian Barnard

35.   Vaccination, Smallpox Vaccine – Edward Jenner

36.   Louis Pasteur -Treatment of Rabies, Cure of Hydrophobia, Pasteurization

37.   Developed one of the first successful polio vaccines (Injectable) - Jonas Edward Salk

38.   Oral Polio Vaccine– Albert Sabin

39.   X-Ray – Wilhelm Roentgen

40.   ElectroCardioGram (ECG) – Williem Einthoven

41.   Electroencephalography (EEG)  – Hans Berger

42.   PCR (Polymerase Chain Reaction) – Kary B Mullis

43.   Colour Blindness –John Dalton

44.   Discovered that the Malaria parasite is transmitted by mosquitoes - Ronald Ross

45.   Charles Louis Alphonse Laveran  discovered parasitic protozoans as causative agents of infectious diseases such as Malaria and Trypanosomiasis.diseases

46.   Super Bug – Anand Mohan Chakrabarty (Developed  genetically engineered bacteria (Pseudomonas, the oil eating bacteria) using plasmid transfer .)

47.   Microscope - Antonie Van Leeuwenhoek

48.   Compound Microscope  was invented by

49.   Zaccharias Janssen and Hans Janssen

50.   Electron Microscope  was invented by - Knoll and Ruska

51.   DNA Fingerprinting- Sir Alec Jeffreys

52.   RNA interference (RNAi) -Andrew Fire & Craig C. Mello

53.   ATP  Discovery -Karl Lohmann

54.   Enzyme (Zymase) - Edward Buchne

55.   The first artificial heart  Jarvik-7 - Designed by  Willem Johan Kolff and Robert Jarvik.

56.   Genetic Code -Marshall Nirenberg

57.   Six  Kingdom Classification  - Carl Woese

58.   Lamarck - Theory of Inheritance of Acquired Characters (Lamarckism)

59.   Fertilization in Flowering Plants - Strasburger 

60.   Discoveries in relation to Tuberculosis Robert Koch

61.   Diphtheria Antitoxin - Emil von Behring

62.   Vitamins – Hopkins

63.   Antiseptic Surgery - Joseph Lister

64.   Magnetic Resonance Imaging (MRI)-

65.   Paul C. Lauterbur & Sir Peter Mansfield Lister

66.   IVF - Robert Edwards

67.   Chemotheraphy - Paul Ehrlich

68.   CT Scan - Godfrey Hounsfield

69.   Gene Therapy – Anderson

70.   Germ Theory of Disease - Louis Pasteur (Robert Koch isolated specific bacteria that cause TB and Cholera. He discovered the role of antibodies in immune response)

71.   Classical Conditioning - Ivan Pavlov

72.   Principles of Law of Inheritance- Gregor Mendel Oparin and Haldane

73.    Theory of Chemical Evolution of Life -Oparin and Haldane

74.   Discovery of Streptomycin - Selman Waksman -

75.   Mutation Theory - Hugo de Vries

76.   Temin and David Baltimore - Reverse Transcription

77.   Artistole - First System of Classification of Living Things

78.   Charles Darwin - Theory of Evolution by Natural Selection

79.   Barabara Maclintok - Jumping Gene in Maize

80.   First Cloned Mammal(Dolly) - Ian Wilmut

81.   August  Weismann -  Germplasm theory

82.   Green Fluorescent Protein (GFP) - Osamu Shimomura

83.   First Hormone (Secretin) -Ernest Starling and William Bayliss

84.    HeLa First Immortal Cell line -George Otto Gey

85.   (Acetyl Co A) Neurotransmitter - Otto Loewi

86.   DNA  Polymerase - Arthur Kornberg (1956)

87.   First Recombinant (rDNA) molecule - Paul Berg

88.   Law of Minimum -Nitrogen as essential nutrient in Plant - Liebig

89.   The alpha helix and beta sheet in Protein Secondary Structure - Linus Pauling

90.   Discovery of Restriction Enzymes and their application in Molecular Genetics -Arber, Nathans, and Smith

91.    Theory of Chemical Evolution of Life

92.   Concept of 'Ecosystem' - A G Tansley

93.   Chromatography - Mikhail Tswett

94.   Gene Linkage - William Bateson

95.   DNA as Genetic Material - Avery–MacLeod–McCarty

96.   Central Dogma of Molecular Biology- Francis Crick

97.   Gene Reguation Mechanism  in Prokaryotes (Lac Operon) - Jacob and Monod

98.   Boveri–Sutton Chromosome Theory (Chromosome Theory of Inheritance)

99.   Dideoxy DNA Sequencing Method- Maxam–Gilbert and Sanger

100.   Addison's disease - Thomas Addison

101. Ribozyme (Catalytic RNAs)-Sidney Altman and Thomas Cech

102. Gene discovery using Express Sequence Tags (ESTs)- Craig Venter

103.  Molecular Mechanisms of Circadian Rhythm -Dr. Michael Rosbash, Dr. Jeffrey Hall,Dr. Michael Young

104. CRISPR technology - Yoshizumi Ishino 

Read More

What are Keystone species? Different types of keystone Species with examples

Definition of Keystone species: Any species whose removal or reduction from an ecosystem adversely affect the overall diversity, stability and trophic structure of an ecosystem

Keystone species definition with examples

The term keystone species was coined by Robert Paine, famous American ecologist during his studies in rocky intertidal ecosystem. He used the term keystone species to indicate the importance of star fish in that ecosystem.

Watch this video for better understanding.

How Keystone species affects an Ecosystem?

Removal of keystone species causes

  • Reduction in prey population
  • Reduction at producer level causing complete imbalance of an ecosystem.
  • Reduces the overall species diversity of an ecosystem
  • Trophic cascade

Different Types of Keystone species

Different types of Keystone species

  • Most often predators:  Tiger, Starfish, Shark, Sea otter, Wolf, Prairie dogs  in northern grasslands, Grizzly bears,
  • Prey: Antarctic krill (food of Blue whale, Dolphins etc), Snowshoe hare in North America
  • Ecosystem engineers: Species that keeps that ecosystem as such.
  • Beaver (making dam, creating an ecosystem), African elephants in African Savanna, (overgraze the grassland preventing the growth of tall plants thus maintaining it as a grass land)
  • Mutualist: Humming birds, bees (pollinating many plant species)
  • Food and nesting source: Saguaro Cactus (Carnegiea gigantea) food and nesting source for many bird and insect species in Desert Ecosystem),Fig (Ficus) in rain forests (as a food source for all species throughout the year)

This are the reasons we are spending lot of money to conserve this species. They are the keystone in the sustenance of that ecosystem. Thank you

Read More

DBT BET JRF Previous Questions and Answers


1.The major difference between hormones that have intracellular receptors and those that have cell membrane receptors is that the former is usually:
a. Charged
b. Hydrophilic
c. Glycosylated
d. Hydrophobic
Ans: d. Hydrophobic
     2. A patient suffering from allergy has been advised to take anti-histamine drugs. Which one of the following biological processes is most likely to be the reason for the allergy?
a. Mast cell degranulation
b. Thymocyte maturation
c. Somatic hypermutation
d. Bystander lysis
Ans: a. Mast cell degranulation
     
 3.  Which one of the following statements is NOT TRUE for an enhancer element?
a. it can be downstream of the gene it regulates
b. it can only regulate a nearby gene
 c. it can be upstream of the gene it regulates
d. it can be within the intron of the gene
Ans: b. it can only regulate a nearby gene

     4. Which one of the following statements about alleles is NOT TRUE?
a. They may occupy different loci in the same chromosome
b. There may be several at one locus
c. One may be dominant over another
     d. They may show co-dominance
Ans: a. They may occupy different loci in the same chromosome
5. Allele ‘A’ is dominant over allele ‘a’ and results in dark skin pigmentation. In a mating of Aa with Aa, if 6 offspring are produced, the probability of all having dark pigment is:
a. 0.18  b. 0.75 c. 0.24  d. 0.12
Ans: a. 0.18  
      6. A bacterial culture grown in a medium containing radioactive sulphur would incorporate the radiolabel in the tetra-peptide:
a. serine-cysteine-tyrosine-methionine.
b. threonine-lysine-aspartic acid-glutamic acid.
c. alanine-proline-histidine-glycine.
d. tryptophan-phenylalanine-valine-isoleucine
Ans: a. serine-cysteine-tyrosine-methionine.
7. Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature is:
a. ATGACATTATTACATTAGTG
b. GCGCGTGCATGCCCGATGCC
c. ATTATTATACGTATTTATAT
d. CGCGATCGGGGATTACGAGC
Ans: b. GCGCGTGCATGCCCGATGCC
8. A peptide of sequence -SHELR- is isolated from bacteria. Which one of the following options lists the possible phosphorylation site in this peptide?
a. H  b. L c. R d. E
Ans: a. H  
9. Competitive inhibition of an enzyme can be reduced by:
a. Reducing the amount of the substrate
b. Increasing the amount of the substrate
c. Decreasing the amount of the enzyme
d. Diluting the reaction mixture
Ans: b. Increasing the amount of the substrate

10.  If a cell carries 21 pairs of chromosomes just after completion of mitotic telophase, how many chromatids will be there in metaphase?
a. 21  b. 42 c. 84  d. 168
Ans: c. 84  
Read More

© Biology Exams 4 U, AllRightsReserved.***Best viewed in Google Chrome and Mozilla firefox***

Maintained by BiologyExams4U.com